View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3707_high_21 (Length: 249)
Name: NF3707_high_21
Description: NF3707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3707_high_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 11 - 240
Target Start/End: Complemental strand, 36669270 - 36669043
Alignment:
| Q |
11 |
aatagtcgttgttgttttcttttatttggctgtcatagtttgaaacaatgttttggtaacatttgaaacacaagcggttaatttggtagaattacggtgt |
110 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36669270 |
aatagtcgttgatgttttcttttatttggctgtcatagtttgaaacaatgttttggtaacatttgaaaca--agcggttaatttggtagaattacggtgt |
36669173 |
T |
 |
| Q |
111 |
gtcgtcaaaattttggtaaaaactacactttaaaattttcaacaaaggcacgatgtcaacataattttgctgtacttgtcatctttgcaaacatgcatta |
210 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36669172 |
gtcatcaaaattttggtaaaaactacactttaaaattttcaacaaaggcacgatgtcaacatgattttgctgtacttgtcatctttgcaaacatgcatta |
36669073 |
T |
 |
| Q |
211 |
aaatggatgttatgccgtactcgtctctct |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36669072 |
aaatggatgttatgccgtactcgtctctct |
36669043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 58 - 215
Target Start/End: Complemental strand, 36675007 - 36674852
Alignment:
| Q |
58 |
atgttttggtaacatttgaaacacaagcggttaatttggtagaattacggtgtgtcgtcaaaattttggtaaaaactacactttaaaattttcaacaaag |
157 |
Q |
| |
|
|||| |||||||||| ||||||||||| ||||| ||||||||||||| ||| || ||||||||||||||||||| || | | |||||||||| |||||| |
|
|
| T |
36675007 |
atgtcttggtaacatctgaaacacaagtggttagtttggtagaattatggtttgccgtcaaaattttggtaaaatctccgc-ttaaaatttt-aacaaaa |
36674910 |
T |
 |
| Q |
158 |
gcacgatgtcaacataat-tttgctgtacttgtcatctttgcaaacatgcattaaaatg |
215 |
Q |
| |
|
||| |||||||| |||| |||||| |||| ||||||||| |||||||||||||||| |
|
|
| T |
36674909 |
tcacaatgtcaacgtaatatttgct-tactcgtcatctttaggaacatgcattaaaatg |
36674852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 4 - 51
Target Start/End: Complemental strand, 36675126 - 36675079
Alignment:
| Q |
4 |
atataataatagtcgttgttgttttcttttatttggctgtcatagttt |
51 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||||| |||| |
|
|
| T |
36675126 |
atataataatagtcctttttgttttcttttatttggctgtcatggttt |
36675079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University