View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3707_high_25 (Length: 237)
Name: NF3707_high_25
Description: NF3707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3707_high_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 41588266 - 41588486
Alignment:
| Q |
1 |
ttaaaactcctcaccggaattgcaccatcaccattaccagttgcaactgcagcaccttgttgttctaacacggtcaatttatcctctccggattcaacct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41588266 |
ttaaaactcctcaccggaattgcaccatcaccattaccagttgcaactgcagcaccttgttgttctaacacggtcaccttatcctctccggattcaacct |
41588365 |
T |
 |
| Q |
101 |
tttctttcatcgccgatcgagtaattcgcttgaaattcttcaccggcacctcaccatcacctttaccaactgcaacagcatcaccttcacctcgctgttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41588366 |
tttctttcatcgccgatcgagtaattcgcttgaaattcttcaccggcacctcaccatcacctttaccaactgcaacagcatcaccttcacctcgctgttc |
41588465 |
T |
 |
| Q |
201 |
taacacagtaaccgtttcctc |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
41588466 |
taacacagtaaccgtttcctc |
41588486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 29 - 187
Target Start/End: Original strand, 41588165 - 41588323
Alignment:
| Q |
29 |
caccattaccagttgcaactgcagcaccttgttgttctaacacggtcaatttatcctctccggattcaaccttttctttcatcgccgatcgagtaattcg |
128 |
Q |
| |
|
|||||| |||| ||||||||||||||||||||| ||||||||| | | | | ||||| ||||||||||| ||||||||| |||||||||| |||||||| |
|
|
| T |
41588165 |
caccatcaccacttgcaactgcagcaccttgttcttctaacacattgactgtctcctcgccggattcaactttttctttcttcgccgatcgcgtaattcg |
41588264 |
T |
 |
| Q |
129 |
cttgaaattcttcaccggcacctcaccatcacctttaccaactgcaacagcatcacctt |
187 |
Q |
| |
|
||| ||| || ||||||| | |||||||||| |||||| |||||| ||| |||||| |
|
|
| T |
41588265 |
cttaaaactcctcaccggaattgcaccatcaccattaccagttgcaactgcagcacctt |
41588323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University