View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3707_high_27 (Length: 236)

Name: NF3707_high_27
Description: NF3707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3707_high_27
NF3707_high_27
[»] chr8 (2 HSPs)
chr8 (1-94)||(14260863-14260956)
chr8 (164-221)||(14260739-14260793)


Alignment Details
Target: chr8 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 14260956 - 14260863
Alignment:
1 attttgtaatgtttaagggtgaattagattgatgtatattcagtttttagctgaatttgaaatttgaattcaatgaaagagtaatgtttgggta 94  Q
    |||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14260956 atttcgtaatgtttaatggtgaattagattgatgtatattcagtttttagctgaatttgaaatttgaattcaatgaaagagtaatgtttgggta 14260863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 164 - 221
Target Start/End: Complemental strand, 14260793 - 14260739
Alignment:
164 aagtatattactagaaagttacagattatcatagttaaataatcagaagagtaaaaag 221  Q
    |||||||||||||||||||||||||||   ||||||||| ||||||||||||||||||    
14260793 aagtatattactagaaagttacagatt---atagttaaacaatcagaagagtaaaaag 14260739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University