View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3707_high_29 (Length: 222)
Name: NF3707_high_29
Description: NF3707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3707_high_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 5e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 5e-55
Query Start/End: Original strand, 74 - 203
Target Start/End: Original strand, 36093459 - 36093590
Alignment:
| Q |
74 |
ttcactggccaagaaatgcttgaaagacttagaagcaaaaatgcacgaagtcgtaccaagaaaatcagaatctgtttctgtgtacaatagatata--tat |
171 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
36093459 |
ttcactgaccaagaaatgcttgaaagacttagaagcaaaaatgcacgaagtcgtaccaagaaaatcagaatctgtttctgtgtacaatagatatattttt |
36093558 |
T |
 |
| Q |
172 |
atttttctttttcatgtttcattagttccaat |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36093559 |
ttttttctttttcatgtttcattagttccaat |
36093590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 18 - 64
Target Start/End: Complemental strand, 39030166 - 39030120
Alignment:
| Q |
18 |
acaaatgtggtgcaaattagtgatcaggatatgaagaatatcacagg |
64 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39030166 |
acaaatttggtgcaaattagtgatcaggatatgaagaatatcacagg |
39030120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University