View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3707_high_30 (Length: 215)
Name: NF3707_high_30
Description: NF3707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3707_high_30 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 67; Significance: 6e-30; HSPs: 9)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 10 - 92
Target Start/End: Original strand, 10084059 - 10084140
Alignment:
| Q |
10 |
aagcataggagagaggaggagtggatgaatgaatggaaaatttgagttgtgactgactcaatttatagacaagaaacatgcaa |
92 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10084059 |
aagcaaagaagagaggaggagtggatgaatgaatggaaaatttgagttgtgactgactcaatttatagacaa-aaacatgcaa |
10084140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 10 - 92
Target Start/End: Original strand, 10096514 - 10096596
Alignment:
| Q |
10 |
aagcataggagagaggaggagtggatgaatgaatggaaaatttgagttgtgactgactcaatttatagacaagaaacatgcaa |
92 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||||||| |||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
10096514 |
aagcaaagaagagaggaggagtggatgaatgaatggaaaatgtgagttgtaactgactgaatttatagacaagaaacatgcaa |
10096596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 92
Target Start/End: Original strand, 10079869 - 10079941
Alignment:
| Q |
19 |
agagaggaggagtggatgaatgaatggaaaatttgagttgtgactgactcaatttatagacaagaaacatgcaa |
92 |
Q |
| |
|
|||||||| | || |||||||||||||||||| || ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
10079869 |
agagaggaagggtagatgaatgaatggaaaatgtgggttgtgactgactcaatttatagacaa-aaacatgcaa |
10079941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 164 - 200
Target Start/End: Original strand, 10080011 - 10080047
Alignment:
| Q |
164 |
caccaaaaggtcaaaaatctttatccatcttttttct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10080011 |
caccaaaaggtcaaaaatctttatccatcttttttct |
10080047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 164 - 200
Target Start/End: Original strand, 10084207 - 10084243
Alignment:
| Q |
164 |
caccaaaaggtcaaaaatctttatccatcttttttct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10084207 |
caccaaaaggtcaaaaatctttatccatcttttttct |
10084243 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 34 - 89
Target Start/End: Original strand, 10086434 - 10086489
Alignment:
| Q |
34 |
atgaatgaatggaaaatttgagttgtgactgactcaatttatagacaagaaacatg |
89 |
Q |
| |
|
||||||||||||||| | | |||||| ||||||||||||||||||||||||||| |
|
|
| T |
10086434 |
atgaatgaatggaaagtgaggattgtgagtgactcaatttatagacaagaaacatg |
10086489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 164 - 198
Target Start/End: Original strand, 10096664 - 10096698
Alignment:
| Q |
164 |
caccaaaaggtcaaaaatctttatccatctttttt |
198 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10096664 |
caccaaaaggtcaaaaacctttatccatctttttt |
10096698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 34 - 82
Target Start/End: Original strand, 10090473 - 10090521
Alignment:
| Q |
34 |
atgaatgaatggaaaatttgagttgtgactgactcaatttatagacaag |
82 |
Q |
| |
|
||||||||| ||||||| | ||||||| |||||||||||||||||||| |
|
|
| T |
10090473 |
atgaatgaagggaaaatgagggttgtgaatgactcaatttatagacaag |
10090521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 34 - 82
Target Start/End: Original strand, 10103931 - 10103979
Alignment:
| Q |
34 |
atgaatgaatggaaaatttgagttgtgactgactcaatttatagacaag |
82 |
Q |
| |
|
||||||||||||||| | | ||||||| |||||||||||||||||||| |
|
|
| T |
10103931 |
atgaatgaatggaaagtgagggttgtgagtgactcaatttatagacaag |
10103979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University