View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3707_high_7 (Length: 372)
Name: NF3707_high_7
Description: NF3707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3707_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 19 - 208
Target Start/End: Complemental strand, 30479514 - 30479325
Alignment:
| Q |
19 |
gtcaatttgtaacagtgaatgttcataatcaatatacctagagaagtaacaatcacatttcgtggctttgtgcatgctattcaatgcatttatgctttta |
118 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
30479514 |
gtcaatttgtaatagtgaatgttcataatcaatatacctagagaagcaactatcacatttcgtggctttgtgcatgctatgctatgcatttatgctttta |
30479415 |
T |
 |
| Q |
119 |
tgacaaatttcaattcgacaatttactcttatgtgagttgtagttctatacattgcttcttgtaccaacaaaacgataaatacaataact |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
30479414 |
tgacaaatttcaattcgacaatttactcttatgtgagttgtagttctatacattgcttcttgtaccaacaaaacaataaatacaacaact |
30479325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 273 - 325
Target Start/End: Complemental strand, 15873906 - 15873854
Alignment:
| Q |
273 |
actaattaaagaaataaatataataaaaatatcttgaaacttatgtcatcaaa |
325 |
Q |
| |
|
|||| ||||||||| ||||||||||| ||| ||||||||||| ||| |||||| |
|
|
| T |
15873906 |
actagttaaagaaacaaatataataagaatttcttgaaacttgtgtaatcaaa |
15873854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University