View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3707_low_11 (Length: 356)
Name: NF3707_low_11
Description: NF3707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3707_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 306; Significance: 1e-172; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 11 - 339
Target Start/End: Original strand, 52810299 - 52810629
Alignment:
| Q |
11 |
ttatactccgtttcttgagatgggttaaagggtaaaactcttaccaatgagttgaaggtcaaaatattatta---attaaattcatctaatgtttggggt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | |
|
|
| T |
52810299 |
ttatactccgtttcttgagatgggttaaagggtaaaactcttaccaatgagttgaaggtcaaaatattattattaattaaattcatctaatgtttggg-t |
52810397 |
T |
 |
| Q |
108 |
tctttcttccatcttttttagaaattaatatagcttgcttgctatatcactttgtttggttcaacttcaagttaataatgttttgttttatctcagagct |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52810398 |
tctttcttccatcttttttagaaattaatatagcttgcttgctatatcactttgtttggttcaacttcaagttaataatgttttgttttatctcagagct |
52810497 |
T |
 |
| Q |
208 |
agcttaccgaaaatcatcactgtggagaatctttctacaacctttgatggcagatctagaacccagaacctcaaaaagtttgtctgccttggctggagca |
307 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52810498 |
agcttaccgaaaatcatcactgtgcagaatctttctacaacctttgatggcagatctagaacccagaacctcaaaaagtttgtctgccttggctggagca |
52810597 |
T |
 |
| Q |
308 |
acatcccatttcctagcagcagctgtaaaaac |
339 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
52810598 |
acatcccatttcctagcagcagctgtaaaaac |
52810629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 17 - 57
Target Start/End: Original strand, 52810228 - 52810268
Alignment:
| Q |
17 |
tccgtttcttgagatgggttaaagggtaaaactcttaccaa |
57 |
Q |
| |
|
||||| ||||||||| |||||||||||||||| |||||||| |
|
|
| T |
52810228 |
tccgtctcttgagataggttaaagggtaaaacccttaccaa |
52810268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University