View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3707_low_16 (Length: 331)
Name: NF3707_low_16
Description: NF3707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3707_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 1 - 319
Target Start/End: Complemental strand, 46813957 - 46813639
Alignment:
| Q |
1 |
tctatgtgggaagatgctgatgatagcttctcgaagagtcctggttcggccacgccagtgagagcaagtcaggatttgagggaggaatttgaggaagctg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
46813957 |
tctatgtgggaagatgctgatgatagcttctcgaagagtcctggttcggccacgccagtgagagcgagtcaggatttgagggaggaatttgaggaagctg |
46813858 |
T |
 |
| Q |
101 |
caaatggtgggattcagagcttggcgcttggtgctctggataacagtttcttggttggtgaaaatgggattcaggttgtgaagaattttgcaactgggat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46813857 |
caaatggtgggattcagagcttggcgcttggtgctctggataacagtttcttggttggtgaaaatgggattcaggttgtgaagaattttgcaactgggat |
46813758 |
T |
 |
| Q |
201 |
tcatggaaaaggggcttttgttaactttggtggtggttcgtcctcaacatcgaagttggtggattgcactcccaagaaaacgcttctcatgaaagccgag |
300 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46813757 |
tcatggaaaaggggtttttgttaactttggtggtggttcgtcctcaacatcgaagttggtggattgcactcccaagaaaacgcttctcatgaaagccgag |
46813658 |
T |
 |
| Q |
301 |
accagcatgcttctgatga |
319 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
46813657 |
accagcatgcttctgatga |
46813639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University