View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3707_low_18 (Length: 307)

Name: NF3707_low_18
Description: NF3707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3707_low_18
NF3707_low_18
[»] chr2 (3 HSPs)
chr2 (66-116)||(11662776-11662826)
chr2 (4-62)||(11662854-11662912)
chr2 (66-116)||(7345552-7345602)


Alignment Details
Target: chr2 (Bit Score: 47; Significance: 8e-18; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 66 - 116
Target Start/End: Complemental strand, 11662826 - 11662776
Alignment:
66 ttattatccaataatgtgaatgaagttccaagtaataatacactttcttgt 116  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||    
11662826 ttattatcaaataatgtgaatgaagttccaagtaataatacactttcttgt 11662776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 4 - 62
Target Start/End: Complemental strand, 11662912 - 11662854
Alignment:
4 gggtagattattctctagtttaaaaatatattgtggcgtctagtttactgtttatttgc 62  Q
    ||||| |||||| ||||||||||||||||||||||||||| ||||| ||||||||||||    
11662912 gggtaaattattttctagtttaaaaatatattgtggcgtcaagtttgctgtttatttgc 11662854  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 66 - 116
Target Start/End: Original strand, 7345552 - 7345602
Alignment:
66 ttattatccaataatgtgaatgaagttccaagtaataatacactttcttgt 116  Q
    |||||||||||||||||||||||| |||||||||||||   ||||||||||    
7345552 ttattatccaataatgtgaatgaatttccaagtaataaactactttcttgt 7345602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University