View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3707_low_21 (Length: 271)
Name: NF3707_low_21
Description: NF3707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3707_low_21 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 17 - 259
Target Start/End: Complemental strand, 46814176 - 46813934
Alignment:
| Q |
17 |
caattgaaaaccctagcggatcagcgacgtgtggattttattgcgaaaggtgtttgggcgatgaaattctttactgaacaggattttgacgtgtttttgg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46814176 |
caattgaaaaccctagcggatcagcgacgtgtggattttattgcgaaaggtgtttgggcgatgaaattctttactgaacaggattttgacgcgtttttgg |
46814077 |
T |
|
| Q |
117 |
tgaagtttcagaattgtacttttgagaatacgcatgggtatgaagctactgatgagaataagcttaaggtttatggtaaggattttcttgggtgggcgaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46814076 |
tgaagtttcagaattgtacttttgagaatacgcatgggtatgaagctactgatgagaataagcttaaggtttatggtaaggattttcttgggtgggcgaa |
46813977 |
T |
|
| Q |
217 |
accggaagtcgctgatgagtctatgtgggaagatgctgatgat |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46813976 |
accggaagtcgctgatgagtctatgtgggaagatgctgatgat |
46813934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University