View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3707_low_22 (Length: 261)
Name: NF3707_low_22
Description: NF3707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3707_low_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 24 - 243
Target Start/End: Complemental strand, 35849725 - 35849506
Alignment:
| Q |
24 |
tatccaaccttaggtgtgatgtttggagcaatttccactaattaaggccagccagctagctgttgttcatataatagttgtttatgtgtacataaatttg |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35849725 |
tatccaaccttaggtgtgatgtttggagcaatttccactaattaaggcaagccagccagctgttgttcatataatagttgtttatgtgtacataaatttg |
35849626 |
T |
 |
| Q |
124 |
ttataggcaatactttttcaattcaattagatggatatatttcattattcttttgtcaaacaagaatacatatactttgtaagataactttaggccatct |
223 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35849625 |
ttatagacaatactttttcaattcaattagatggatatatttcattattcttttgtcaaacaagaatacatatactttgtaagataactttaggccatct |
35849526 |
T |
 |
| Q |
224 |
ctttccattgatgtgatagt |
243 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
35849525 |
ctttccattgatgtgatagt |
35849506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University