View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3707_low_26 (Length: 249)
Name: NF3707_low_26
Description: NF3707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3707_low_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 107; Significance: 9e-54; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 88 - 244
Target Start/End: Complemental strand, 1826114 - 1825961
Alignment:
| Q |
88 |
aaatagtttttgtaaatttagtgttgggtcatgtgaagtgtctagaggatcatctctattatgaacaacttttggaggaggattactctaaaaaggaact |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| |||||||||||||||||||||| |||||||||||||||| || |
|
|
| T |
1826114 |
aaatagtttttgtaaatttagtgttgggtcatgagaagtgtctagaggatcatatctgttatgaacaacttttggaggagaattactctaaaaaggacct |
1826015 |
T |
 |
| Q |
188 |
aaaagctacaactacactattctagtaacaaactaattattcattcattcatctcac |
244 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||| |||| |||||||| |||| |
|
|
| T |
1826014 |
aaaagctacaactacactattc---taaaaaactaattcttcactcattcatttcac |
1825961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 1826511 - 1826464
Alignment:
| Q |
1 |
cttataataatcactgaagctatttctttatgtatttactgtttattt |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1826511 |
cttataataatcactgaagctatttctttatgtgtttactgtttattt |
1826464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 42 - 86
Target Start/End: Complemental strand, 806590 - 806545
Alignment:
| Q |
42 |
tttattttgagaatgagcaaaactgtttggat-aagagcagaattc |
86 |
Q |
| |
|
|||| ||||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
806590 |
tttactttgagaatgagcaaaactgtttgggtaaagagcagaattc |
806545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 48
Target Start/End: Original strand, 1471870 - 1471917
Alignment:
| Q |
1 |
cttataataatcactgaagctatttctttatgtatttactgtttattt |
48 |
Q |
| |
|
||||||||||||| |||| |||| | |||||||||||||||||||||| |
|
|
| T |
1471870 |
cttataataatcattgaaactatatatttatgtatttactgtttattt |
1471917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 42 - 86
Target Start/End: Original strand, 33450067 - 33450112
Alignment:
| Q |
42 |
tttattttgagaatgagcaaaactgtttggataa-gagcagaattc |
86 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||| ||||||||||| |
|
|
| T |
33450067 |
tttattttgagaatgagcaaaacagtttgggtaatgagcagaattc |
33450112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University