View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3707_low_27 (Length: 245)
Name: NF3707_low_27
Description: NF3707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3707_low_27 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 17 - 245
Target Start/End: Complemental strand, 40038446 - 40038218
Alignment:
| Q |
17 |
gaagatcaagtgaaacgtggttacttgaggcaccgcattccccaacaacaatagaaatcaagctaaactccgtaagccacattgttttggccagtagagg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40038446 |
gaagatcaagtgaaacgtggttacttgaggcaccgcattccccaacaacaatagaaatcaagctaaactccgtaagccacattgttttggccagtagagg |
40038347 |
T |
 |
| Q |
117 |
taatgtttgcctataaaataccggtggaggtacttttacaaaatttatccttttatactttacttttatgtcttctttagttcacaccatattacactca |
216 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40038346 |
taatgtttgcctataaaataccggtgaaggtacttttacaaaatttatccttttatactttacttttatgtcttctttagttcacaccatattacactca |
40038247 |
T |
 |
| Q |
217 |
ccataggaaccaaaccgagagaggtaaac |
245 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40038246 |
ccataggaaccaaaccgagagaggtaaac |
40038218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University