View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3707_low_31 (Length: 236)
Name: NF3707_low_31
Description: NF3707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3707_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 14260956 - 14260863
Alignment:
| Q |
1 |
attttgtaatgtttaagggtgaattagattgatgtatattcagtttttagctgaatttgaaatttgaattcaatgaaagagtaatgtttgggta |
94 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14260956 |
atttcgtaatgtttaatggtgaattagattgatgtatattcagtttttagctgaatttgaaatttgaattcaatgaaagagtaatgtttgggta |
14260863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 164 - 221
Target Start/End: Complemental strand, 14260793 - 14260739
Alignment:
| Q |
164 |
aagtatattactagaaagttacagattatcatagttaaataatcagaagagtaaaaag |
221 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
14260793 |
aagtatattactagaaagttacagatt---atagttaaacaatcagaagagtaaaaag |
14260739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University