View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3707_low_9 (Length: 402)

Name: NF3707_low_9
Description: NF3707
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3707_low_9
NF3707_low_9
[»] chr3 (2 HSPs)
chr3 (18-173)||(29485305-29485460)
chr3 (333-392)||(29485464-29485526)


Alignment Details
Target: chr3 (Bit Score: 144; Significance: 1e-75; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 18 - 173
Target Start/End: Original strand, 29485305 - 29485460
Alignment:
18 agatacttcatgtcaatatcattattataaaaaagagtcatactttagcttgattacatggtaaagaactaaaatatcaatctttcacttcaaatttgta 117  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
29485305 agatacttcatatcaatatcattattataaaaaagagtcatactttagcttgattacatggtaaagaactaaaatatcaatctttcacttcaaatttcta 29485404  T
118 ctcttaattaaatgaccactttataactgtgtttcaattgttcgtctattcaacat 173  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
29485405 ctcttaattaaatgagcactttataactgtgtttcaattgttcgtctattcaacat 29485460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 333 - 392
Target Start/End: Original strand, 29485464 - 29485526
Alignment:
333 gtttatataggagttgggttaaaaaacaacc---taaaaatttagggttggaccgtccctttg 392  Q
    |||||||||||||||||||||||||||||||   ||||| |||||||||||||||||||||||    
29485464 gtttatataggagttgggttaaaaaacaacctaataaaattttagggttggaccgtccctttg 29485526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University