View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3708_low_10 (Length: 241)
Name: NF3708_low_10
Description: NF3708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3708_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 44729182 - 44729052
Alignment:
| Q |
1 |
tgtgctacaagttttatcagaatacttttccccatcaaaaaataaactcttatcccacacagtcaataaagaaattcaacacttcttgtttaggtttcct |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44729182 |
tgtgctacaagttttatcagaatacgtttccccatcaaaaaataaactcttatcccacacagtcaataaagaaattcaacacttcttgtttaggtttcct |
44729083 |
T |
|
| Q |
101 |
cgcataagtggtaatccaaggtactttgcaa |
131 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
44729082 |
cgcataagtggtaatccaaggtactttgcaa |
44729052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 168 - 223
Target Start/End: Complemental strand, 44728690 - 44728635
Alignment:
| Q |
168 |
agcaagatttaataggtttgtcaatgatgagaatagaaaaagttcattgttaacac |
223 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44728690 |
agcaagatttaataggtctgtcaatgatgagaatagaaaaagttcattgttaacac |
44728635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University