View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3708_low_11 (Length: 236)
Name: NF3708_low_11
Description: NF3708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3708_low_11 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 25 - 234
Target Start/End: Complemental strand, 15251162 - 15250953
Alignment:
| Q |
25 |
tcaaagcttgtatgatggataatatgaaattgtttaattagatcaaaagggttagtgcaagcattaattccacatttactcaaattgcttgccttcatga |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15251162 |
tcaaagcttgtatgatggataatatgaaattgtttaataagatcaaaagggttagtgcaagcattaattccacatttacacaaattgcttgccttcatga |
15251063 |
T |
|
| Q |
125 |
tgctcatagtactcgatattctactgttcgttgggagcgggcaacaattggatatattgctttgatttaacgtcttgtggcggaattcttctatatgatg |
224 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| || |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
15251062 |
tgctcatagtactcgaagttctactgttcgttgggagtggacaacaattggatatattgctttgatttagcgtcttgtggcggaattcttctatatgatg |
15250963 |
T |
|
| Q |
225 |
acaaatttat |
234 |
Q |
| |
|
|||||||||| |
|
|
| T |
15250962 |
acaaatttat |
15250953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 28 - 149
Target Start/End: Complemental strand, 8254556 - 8254435
Alignment:
| Q |
28 |
aagcttgtatgatggataatatgaaattgtttaattagatcaaaagggttagtgcaagcattaattccacatttactcaaattgcttgccttcatgatgc |
127 |
Q |
| |
|
|||||||||||||| |||||||||| |||||| || | ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
8254556 |
aagcttgtatgatgcataatatgaatttgttttataatatcaaaagggttagtgcaagcattaattccacatttactcaaattgcttgcattcatgatgt |
8254457 |
T |
|
| Q |
128 |
tcatagtactcgatattctact |
149 |
Q |
| |
|
| |||| |||||| |||||||| |
|
|
| T |
8254456 |
tgataggactcgagattctact |
8254435 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University