View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3708_low_13 (Length: 217)
Name: NF3708_low_13
Description: NF3708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3708_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 19 - 200
Target Start/End: Original strand, 35522274 - 35522450
Alignment:
| Q |
19 |
tattgaagaaaaatgtatattaattgaaaggtttttatcttcttaaaaggcaaagaaattttattaatgtaaatacagctatcagaagtagtgcacgagt |
118 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35522274 |
tattgaagaaaaatgtatattaattcaaaggtttttatcttattaaaaggcaaagaaattttattaatgtaaatacagctatcagaagtagtgcacgagt |
35522373 |
T |
 |
| Q |
119 |
ggaaaaatgcacatattatgattggaacatatgcatgtctagtctagaaccacgactacaaactgacaacaaagcaagccta |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35522374 |
ggaaaaatgtacatattatgattggaacatatgcat-----gtctagaaccacgactacaaactgacaacaaagcaagccta |
35522450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University