View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3708_low_14 (Length: 205)
Name: NF3708_low_14
Description: NF3708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3708_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 164; Significance: 7e-88; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 20 - 187
Target Start/End: Complemental strand, 44525438 - 44525271
Alignment:
| Q |
20 |
agttcttcacgagccggcacgtgaagttgatcacagtgagattaattcagacaagattcagaagattatcgatgacatgattcttgtcatgagaaatgct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44525438 |
agttcttcacgagccggcacgtgaagttgatcacagtgagattaattcagacaagattcagaagattatcgatggcatgattcttgtcatgagaaatgct |
44525339 |
T |
|
| Q |
120 |
cctggaattagtctttctgctcaaaaaattggtatccccttaagggtatgtatgaatcaatatttcat |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44525338 |
cctggaattagtctttctgctcaaaaaattggtatccccttaagggtatgtatgaatcaatatttcat |
44525271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 20 - 169
Target Start/End: Complemental strand, 44530226 - 44530077
Alignment:
| Q |
20 |
agttcttcacgagccggcacgtgaagttgatcacagtgagattaattcagacaagattcagaagattatcgatgacatgattcttgtcatgagaaatgct |
119 |
Q |
| |
|
|||| |||| ||||| |||||||| |||||||||||||||||||| ||||||||||||||||| ||||| ||||| |||||||||||||||||||| || |
|
|
| T |
44530226 |
agttattcatgagcctgcacgtgaggttgatcacagtgagattaaatcagacaagattcagaatattattgatgatatgattcttgtcatgagaaaagcc |
44530127 |
T |
|
| Q |
120 |
cctggaattagtctttctgctcaaaaaattggtatccccttaagggtatg |
169 |
Q |
| |
|
|||||| | || || |||| | | ||||||||||||||||||||||||| |
|
|
| T |
44530126 |
cctggagtaggtgttgctgccccacaaattggtatccccttaagggtatg |
44530077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University