View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3708_low_6 (Length: 313)
Name: NF3708_low_6
Description: NF3708
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3708_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 303
Target Start/End: Complemental strand, 26449272 - 26448968
Alignment:
| Q |
1 |
ttgcaatctctgtggtgctgctcaggaatcctctcaacacttgtttatggactgctcttttgcatctcaattatggtcttggctagctgcaatactcaac |
100 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
26449272 |
ttgcaatctctgtagtgctgctcaggaatcctctcgacacttgtttatggactgctcttttgcatctcaattatggtcttagctagctgcaattctcaac |
26449173 |
T |
|
| Q |
101 |
ttgaactgcaccttcacatctttcctagacatcattagaatttcagacaaaaactggactccacaatgtaagctggtgattttatatgc--taattcatt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |||||| ||||||||| ||||||||||||||||| ||| ||||||||| |
|
|
| T |
26449172 |
ttgaactgcaccttcacatctttcctagtcatcattagaatttcagacagaaactgatctccacaatttaagctggtgattttatctgctataattcatt |
26449073 |
T |
|
| Q |
199 |
gctttcatactattttgcattgcaaaaatcagagaagattcaatgataagaaaattttggtcccatctgctattaatcttattatttttggtacatctat |
298 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
26449072 |
gctttcatactatttggcattgcaaaaatcagagaagattcaatgataagaaaattttggtcccatttgctattaatcttattatttctggtacatctat |
26448973 |
T |
|
| Q |
299 |
ctctg |
303 |
Q |
| |
|
||||| |
|
|
| T |
26448972 |
ctctg |
26448968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University