View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3709_high_14 (Length: 276)
Name: NF3709_high_14
Description: NF3709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3709_high_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 109; Significance: 7e-55; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 18 - 158
Target Start/End: Complemental strand, 23701521 - 23701381
Alignment:
| Q |
18 |
agtagatgatatctccctcttagtctttcatgatcatgatgaagaaatttttcaattatgtgatgagacatatgcagaagaattacaaatacaagaagca |
117 |
Q |
| |
|
||||||||||||||||||||||| | | ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23701521 |
agtagatgatatctccctcttagccctacatgatcatgatgaagaaatttttcgattatgtgatgagacatatgcagaagaattacaaatacaagaagca |
23701422 |
T |
|
| Q |
118 |
ttattattttccactcttggggcaaatactactatagatgt |
158 |
Q |
| |
|
|||||||||||| ||||| | ||||||||||||||||||| |
|
|
| T |
23701421 |
ttattattttccgctcttatgtcaaatactactatagatgt |
23701381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 51 - 158
Target Start/End: Original strand, 23694327 - 23694434
Alignment:
| Q |
51 |
tcatgatgaagaaatttttcaattatgtgatgagacatatgcagaagaattacaaatacaagaagcattattattttccactcttggggcaaatactact |
150 |
Q |
| |
|
||||||| |||||||||||| | ||| ||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
23694327 |
tcatgataaagaaatttttcgaatatctgaagagacatatgcagaggaattacaaatacaagaagcattattattttccactcttatgtcaaatactact |
23694426 |
T |
|
| Q |
151 |
atagatgt |
158 |
Q |
| |
|
|||||||| |
|
|
| T |
23694427 |
atagatgt |
23694434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 222 - 269
Target Start/End: Complemental strand, 23701323 - 23701276
Alignment:
| Q |
222 |
ggcttttgtaggtgaatattctttgtcgccgtcttattcttcatctca |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23701323 |
ggcttttgtaggtgaatattctttgtcgccgtcttattcttcttctca |
23701276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University