View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3709_high_16 (Length: 261)
Name: NF3709_high_16
Description: NF3709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3709_high_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 8 - 259
Target Start/End: Complemental strand, 50654524 - 50654274
Alignment:
| Q |
8 |
gacatcatcacaaggaaggtttagcagggaaagagttaaacaaggagggattgggtgagggaagacttatgtgctactcttaattttttaatatatctga |
107 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50654524 |
gacatcataacaaggaaggtttagcagggaaagagttaaacaaggagggattgggtgagggaagacttatgtgctactcttaattttttaatatatctga |
50654425 |
T |
|
| Q |
108 |
accctttaattattttaatagatccaatagtacactggtgaggaacttgatggctctctcaccttagaagccaccaagtttataacctatgttattccat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
50654424 |
accctttaattattttaatagatccaatggtacactggtgaggaacttgatggctctctcacctt-tctgccaccaagtttataacctatgttattccat |
50654326 |
T |
|
| Q |
208 |
tctctcatcctatacnnnnnnngactggggtagaagggtgatgatgtccatc |
259 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
50654325 |
tctctcatcctatactttttttgactggggtagaagggtgatgatgttcatc |
50654274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University