View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3709_high_20 (Length: 249)
Name: NF3709_high_20
Description: NF3709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3709_high_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 9e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 10 - 231
Target Start/End: Complemental strand, 7962655 - 7962435
Alignment:
| Q |
10 |
attatacttctacttcacttacttattttactctcggagtatttgcagataccacctctctccgttaacttatatgaaacatgctcaatattctctcata |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7962655 |
attatacttctacttcacttacttattttactgtcggagtatttgcagataccacctctctccgttaacttatatgaaacatgctcaatattctctcata |
7962556 |
T |
 |
| Q |
110 |
gccatgctcttgatgtagttcggatcccactatatgtagggnnnnnnnnnnnnnaggcactatatgtatgtaggtagtatttttaacaattaatataata |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
7962555 |
gccatgctcttgatgtagttcggat-ccactatatgtagggtttttctttttttaggcactatatgtaggtaggtagtatttataacaattaatataata |
7962457 |
T |
 |
| Q |
210 |
ttagtgtatgcgggtactacgt |
231 |
Q |
| |
|
||||||||||| |||||||||| |
|
|
| T |
7962456 |
ttagtgtatgcaggtactacgt |
7962435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University