View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3709_high_27 (Length: 237)
Name: NF3709_high_27
Description: NF3709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3709_high_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 5)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 6365280 - 6365501
Alignment:
| Q |
1 |
agcactaatcagccagagagccacagaacggcggaacaaggcggtggcagtgtcaagtacagtaccggcaacatcaccagcaaaatcgaagataccgcca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |||||||| |||||||||||| || | || |
|
|
| T |
6365280 |
agcactaatcagccagagagccacagaacggcggaacaaggaggtggcagtgtcagctacagtaccggcagcatcaccaacaaaatcgaagaaactgtca |
6365379 |
T |
|
| Q |
101 |
aatgcaccaccggcgctttgagctgcagtcagttcgttgatgtctaagacattcttttgcatcaacaccacagttcccttcaccttttggtgcttatcaa |
200 |
Q |
| |
|
| | ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6365380 |
actacaccaccggcgctttgagctgcagtgagttcgttgatgtctaagacattcttttgcatcaacaccacagttcccttcaccttttggtgcttatcaa |
6365479 |
T |
|
| Q |
201 |
agagacctttcaccaatgaact |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
6365480 |
agagacctttcaccaatgaact |
6365501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 151 - 208
Target Start/End: Original strand, 6355996 - 6356053
Alignment:
| Q |
151 |
attcttttgcatcaacaccacagttcccttcaccttttggtgcttatcaaagagacct |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
6355996 |
attcttttgcatcaacaccacagttcccttcaacttttggcctctatcaaagagacct |
6356053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 150 - 207
Target Start/End: Original strand, 7463096 - 7463153
Alignment:
| Q |
150 |
cattcttttgcatcaacaccacagttcccttcaccttttggtgcttatcaaagagacc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
7463096 |
cattcttttgcatcaacaccacagttcccttcaacttttggcctctatcaaagagacc |
7463153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 116 - 190
Target Start/End: Original strand, 6340050 - 6340124
Alignment:
| Q |
116 |
ctttgagctgcagtcagttcgttgatgtctaagacattcttttgcatcaacaccacagttcccttcaccttttgg |
190 |
Q |
| |
|
|||||||||||||| | ||||||||| || || |||||||| |||||||| | ||| || ||||||||||||||| |
|
|
| T |
6340050 |
ctttgagctgcagtgatttcgttgatatccaatacattcttatgcatcaatatcactgtccccttcaccttttgg |
6340124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 143 - 180
Target Start/End: Original strand, 6426635 - 6426672
Alignment:
| Q |
143 |
tctaagacattcttttgcatcaacaccacagttccctt |
180 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6426635 |
tctaacacattcttttgcatcaacaccacagttccctt |
6426672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University