View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3709_low_11 (Length: 342)
Name: NF3709_low_11
Description: NF3709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3709_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 1 - 326
Target Start/End: Original strand, 14526900 - 14527225
Alignment:
| Q |
1 |
gataacatgtggccatcaagtagagcataacacaagcatctttgttccgaattttgttgcgactatggagaagattagcgagcagatgcgcagtaccggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14526900 |
gataacatgtggccatcaagtagagcataacacaagcatctttgttccgaattttgttgcaactatggagaagattagcgagcagatgcgcagtaccggc |
14526999 |
T |
|
| Q |
101 |
ttcggcacagcagttacagggacaggacctgatgataactatggcctagcacaatgctatggagatctttcattacttgactgtgtgttgtgttatgctg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
14527000 |
ttcggcacagcagttacagggacaggacctgatgataactatggcctagcacaatgctatggatatctttcattacttgactgtgtgttgtgttatgctg |
14527099 |
T |
|
| Q |
201 |
aggcgcgcacggttcttcctcagtgcttcccttataactccggtcacatttaccttgatggttgcttcacgaggtctgcgaactatagnnnnnnnagtga |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| ||||||||| ||||| |
|
|
| T |
14527100 |
aggcgcgcacggttcttcctcagtgcttcccttataactccggtcgcatttaccttgatggttgcttcatgaggtctgtgaactatagtttttttagtga |
14527199 |
T |
|
| Q |
301 |
gtatacaggaaaagaagatagaactg |
326 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
14527200 |
gtatacaggaaaagaagatagaactg |
14527225 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University