View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3709_low_16 (Length: 276)

Name: NF3709_low_16
Description: NF3709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3709_low_16
NF3709_low_16
[»] chr4 (3 HSPs)
chr4 (18-158)||(23701381-23701521)
chr4 (51-158)||(23694327-23694434)
chr4 (222-269)||(23701276-23701323)


Alignment Details
Target: chr4 (Bit Score: 109; Significance: 7e-55; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 109; E-Value: 7e-55
Query Start/End: Original strand, 18 - 158
Target Start/End: Complemental strand, 23701521 - 23701381
Alignment:
18 agtagatgatatctccctcttagtctttcatgatcatgatgaagaaatttttcaattatgtgatgagacatatgcagaagaattacaaatacaagaagca 117  Q
    ||||||||||||||||||||||| | | ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
23701521 agtagatgatatctccctcttagccctacatgatcatgatgaagaaatttttcgattatgtgatgagacatatgcagaagaattacaaatacaagaagca 23701422  T
118 ttattattttccactcttggggcaaatactactatagatgt 158  Q
    |||||||||||| |||||  | |||||||||||||||||||    
23701421 ttattattttccgctcttatgtcaaatactactatagatgt 23701381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 51 - 158
Target Start/End: Original strand, 23694327 - 23694434
Alignment:
51 tcatgatgaagaaatttttcaattatgtgatgagacatatgcagaagaattacaaatacaagaagcattattattttccactcttggggcaaatactact 150  Q
    ||||||| |||||||||||| | ||| ||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||  | |||||||||||    
23694327 tcatgataaagaaatttttcgaatatctgaagagacatatgcagaggaattacaaatacaagaagcattattattttccactcttatgtcaaatactact 23694426  T
151 atagatgt 158  Q
    ||||||||    
23694427 atagatgt 23694434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 222 - 269
Target Start/End: Complemental strand, 23701323 - 23701276
Alignment:
222 ggcttttgtaggtgaatattctttgtcgccgtcttattcttcatctca 269  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||    
23701323 ggcttttgtaggtgaatattctttgtcgccgtcttattcttcttctca 23701276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University