View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3709_low_21 (Length: 249)
Name: NF3709_low_21
Description: NF3709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3709_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 9020423 - 9020661
Alignment:
| Q |
1 |
aatagaaaatagaaatggataataaggtaactagataactcgtgctctatgtatatagggtcgctgcacgtattggaccttgtcaacgaacatgccacga |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9020423 |
aatagaaaacagaaatggataataaggtaactagctaactcgtgctctatgtatatagggtcgctgcacgtattggaccttgtcaacgaacatgccacga |
9020522 |
T |
 |
| Q |
101 |
agttaagagctaccaaccgaatgtgggacaccacatacccctcaacaacgaaaaacttatgcactacacacacaaattgttgatcaaggctaatcgttgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9020523 |
agttaagagctaccaaccgaatgtgggacaccacatacccctcaacaaggaaaaacttatgcactacacaaacaaattgttgatcaaggctaatcgttgt |
9020622 |
T |
 |
| Q |
201 |
aggttatgttatttgaccaatatgaataattttgcctat |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9020623 |
aggttatgttatttgaccaatatgaataattttgcctat |
9020661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University