View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3709_low_23 (Length: 242)
Name: NF3709_low_23
Description: NF3709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3709_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 14 - 226
Target Start/End: Complemental strand, 25372041 - 25371839
Alignment:
| Q |
14 |
gaatatgtgcaatgttggtggagggagtagtgatgtgttgagaagtcttgaggaagagattgtaccagcttctccacaaaagaggatgttcttggaacat |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
25372041 |
gaatatgtgcaatgttggtggagggagtagtgatgtgttgagaagtcttgaggaagagattgtaccaccttctccacaaaagaggatgttcttggaacat |
25371942 |
T |
 |
| Q |
114 |
aacttctagttttaaccatatgtagcttgatgcaaactcaggttttaattctcatttcactgtggcgtttgagatgattttccttgtaattgctgctaca |
213 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25371941 |
aacttctagttttaaccatgtgtagcttgatgcaaactcaggttttaa----------cctgtggcgtttgagatgattttccttgtaattgctgctaca |
25371852 |
T |
 |
| Q |
214 |
tgtaatttatttt |
226 |
Q |
| |
|
||||||||||||| |
|
|
| T |
25371851 |
tgtaatttatttt |
25371839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 43 - 126
Target Start/End: Original strand, 42357583 - 42357666
Alignment:
| Q |
43 |
gtgatgtgttgagaagtcttgaggaagagattgtaccagcttctccacaaaagaggatgttcttggaacataacttctagtttt |
126 |
Q |
| |
|
||||||| |||||||||||||||||||| |||| || |||||||| ||| |||| | |||||| |||| |||||||| |||| |
|
|
| T |
42357583 |
gtgatgttttgagaagtcttgaggaagaaattggtcctgcttctcctcaagagagactcttcttgcaacacaacttctaatttt |
42357666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University