View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3709_low_27 (Length: 238)
Name: NF3709_low_27
Description: NF3709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3709_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 9020410 - 9020205
Alignment:
| Q |
1 |
tgtctaatgtcctcaaaacccatatagtcctcagtagacttgagaaataatcgactaactcttgttcagctgtagtagcgttcactaaatattttctcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
9020410 |
tgtctaatgtcctcaaaacccatatagttcttagtagacttgacaaataatcgactaactcttgttcagctgtagtagcgttcgctaaatattttctcag |
9020311 |
T |
|
| Q |
101 |
cggaaggactggtatgtccttaaatcgtctatttggcgatgataaaaaagttttagacgt-aaccaaattctttcgtaattaatcataactataaaattt |
199 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
9020310 |
ctgaaggactggtatgtccttaaatcgtctatttggcgatgataaaaaagttttagacgtaaaccaaattctttcgtagttaatcataactgtaaaattt |
9020211 |
T |
|
| Q |
200 |
acttgt |
205 |
Q |
| |
|
|||||| |
|
|
| T |
9020210 |
acttgt |
9020205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University