View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3709_low_31 (Length: 235)
Name: NF3709_low_31
Description: NF3709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3709_low_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 9518557 - 9518767
Alignment:
| Q |
1 |
accccagttgtctaccttcttaggaatgtaaacctaccccacccaaccaaaaggagcaaagaccttgaaaagatctctgtgatatgatccttatggaatg |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || | | ||||||||||||||||| |
|
|
| T |
9518557 |
accccatttgtctaccttcttaggaatgtaaacctaccccacccaaccaaaatgagcaaagaccttgaaaagatcactattagatgatccttatggaatg |
9518656 |
T |
|
| Q |
101 |
ttaaagaagaaaaaggatgtagagatcttatccaactcccgaactctcccctgtcgttggtgaacttttcccatcctcacatttttaaaaaccctagtgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9518657 |
ttaaagaagaaaaaggatgtagagatcttatccaactcccgaactctcccctgccgttggtgaacttttcccaccctcacatttttaaaaaccctagtgg |
9518756 |
T |
|
| Q |
201 |
acccatccctc |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
9518757 |
acccatccctc |
9518767 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University