View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3709_low_34 (Length: 227)
Name: NF3709_low_34
Description: NF3709
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3709_low_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-122; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 24529268 - 24529488
Alignment:
| Q |
1 |
caacacaatgccgaactgtttatgtcattcaccgttttcgtcaacgctgtcctcgctctccgtagctcacctcacatccggaagttctgtctcctctgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24529268 |
caacacaatgccgaactgtttatgtcattcaccgttttcgtcaacgctgtcctcgctctccgtagctcacctcacatccggaagttctgtctcctctgtt |
24529367 |
T |
 |
| Q |
101 |
atgactccgaacctaaaaccttctacacacactcagtcaatgcgtggattcggactgccgttgggccccacctccaggaatttcatctcaggatcgaggg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24529368 |
atgactccgaacctaaaaccttctacacacactcagtcaatgcgtggattcggactgccgttgggccccacctccaggaatttcatctcaggatcgaggg |
24529467 |
T |
 |
| Q |
201 |
agatgacttcacccttcctat |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
24529468 |
agatgacttcacccttcctat |
24529488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 28 - 70
Target Start/End: Original strand, 26026510 - 26026552
Alignment:
| Q |
28 |
ttcaccgttttcgtcaacgctgtcctcgctctccgtagctcac |
70 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||| |||||| |
|
|
| T |
26026510 |
ttcaccgttttcgtcaacactgtcctctctctccgtcgctcac |
26026552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 161 - 190
Target Start/End: Original strand, 26026643 - 26026672
Alignment:
| Q |
161 |
ttgggccccacctccaggaatttcatctca |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
26026643 |
ttgggccccacctccaggaatttcatctca |
26026672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University