View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3710_high_106 (Length: 238)
Name: NF3710_high_106
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3710_high_106 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 149
Target Start/End: Complemental strand, 7962140 - 7961993
Alignment:
| Q |
1 |
tcctatttttatccgaaattaaatgtatagtataagtaaagtggggggaatgaaaaattagagagtgaaaaccgagtggttgctataaagaagtaatact |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7962140 |
tcctatttttatccaaaattaaatgtatagtataagtaaagtggggg-aatgaaaaattacatagtgaaaaccgagtggttgctataaagaagtaatact |
7962042 |
T |
|
| Q |
101 |
caccacctctcttcctaattatgtggagctaaggatgattgaagtggga |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7962041 |
caccacctctcttcctaattatgtggagctaagaatgattgaagtggga |
7961993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 152 - 202
Target Start/End: Complemental strand, 7957638 - 7957588
Alignment:
| Q |
152 |
ttgcacaaataggaagggatagcaccacatttattctatattccacaccca |
202 |
Q |
| |
|
||||||||| | ||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
7957638 |
ttgcacaaaaaagaagggatagcaccacattcatcctatattccacaccca |
7957588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University