View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3710_high_113 (Length: 235)
Name: NF3710_high_113
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3710_high_113 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 79 - 220
Target Start/End: Complemental strand, 9518470 - 9518330
Alignment:
| Q |
79 |
tctgttgacagaaggggtgatggaggagcttcggcggagtttcgtggcatacctgcgtgtcctgacgaaagctaagaaagttcatatgtggttgttaatg |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9518470 |
tctgttgacagaaggggtgatggaggagcttcggcggagtt-cgtggcatacatgcgtgtcctgacgaaagctaagaaagttcatatgtggttgttaatg |
9518372 |
T |
|
| Q |
179 |
gaggggtggaaaagtctaaaggtggcatcaatgggtgataac |
220 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9518371 |
gagggttggaaaagtctaaaggtggcatcaatgggggataac |
9518330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University