View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3710_high_114 (Length: 234)

Name: NF3710_high_114
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3710_high_114
NF3710_high_114
[»] chr5 (1 HSPs)
chr5 (14-224)||(4313097-4313307)


Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 14 - 224
Target Start/End: Original strand, 4313097 - 4313307
Alignment:
14 gtttccactctgaatgatcagctaagctaataaagaattctggaccgggaccgattaaagcaactgaacctcttcttaggattggacaatcttcaacagg 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4313097 gtttccactctgaatgatcagctaagctaataaagaattctggaccgggaccgattaaagcaactgaacctcttcttaggattggacaatcttcaacagg 4313196  T
114 aagtttattgaatggtgtgccttgtgcttctaatgtcccttgaattaatgcaaatggaggaccaaaaccagcctgcaaaataagaactcgtttaccatca 213  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4313197 aagtttgttgaatggtgtgccttgtgcttctaatgtcccttgaattaatgcaaatggaggaccaaaaccagcctgcaaaataagaactcgtttaccatca 4313296  T
214 tcaaccactac 224  Q
    |||||||||||    
4313297 tcaaccactac 4313307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University