View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3710_high_115 (Length: 233)

Name: NF3710_high_115
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3710_high_115
NF3710_high_115
[»] chr1 (1 HSPs)
chr1 (16-218)||(26489574-26489776)


Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 16 - 218
Target Start/End: Complemental strand, 26489776 - 26489574
Alignment:
16 atgaagtatgtaggaaattgannnnnnnnaatacttacgagtcactaaaagggtagattacataacgtccatcctgtttttccacttcttcttgcaactg 115  Q
    |||||||||||||||||||||        ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||    
26489776 atgaagtatgtaggaaattgattttttttaatacttacgagtcactaaaaaggtagattacataacgtccatcctgtttttccacttcttcttgaaactg 26489677  T
116 atgtgcttgttgcataggatctgcttcctctcgctgttgctgctgctgctcatcgggtactacctcaggcacgatcgaaggttgtgtggtgggaggaggt 215  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26489676 atgtgcttgttgcataggatctgcttcttctcgctgttgctgctgctgctcatcgggtactacctcaggcacgatcgaaggttgtgtggtgggaggaggt 26489577  T
216 agt 218  Q
    |||    
26489576 agt 26489574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University