View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3710_high_118 (Length: 232)
Name: NF3710_high_118
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3710_high_118 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 141 - 198
Target Start/End: Original strand, 37760733 - 37760790
Alignment:
| Q |
141 |
acccttgcttatttaccatttcaacgttcaaaatgaacaattaacaaagaattcaagc |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37760733 |
acccttgcttatttaccatttcaacgttcaaaatgaacaattaacaaagaattcaagc |
37760790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 22 - 70
Target Start/End: Original strand, 37760611 - 37760659
Alignment:
| Q |
22 |
catgacgtggtaggatgcgaatatgcagaaacaaaattctcgattatac |
70 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
37760611 |
catgacgtggtagaatgcgattatgcagaaacaaaattctcgattatac |
37760659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University