View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3710_high_122 (Length: 227)
Name: NF3710_high_122
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3710_high_122 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 1249512 - 1249738
Alignment:
| Q |
1 |
aaggtaactggacaggcagctccactgtcgttgacaatcggtaaacattgctaactgtgtaaccttttccgtagtaagtttagtcttttattttcaaaat |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
1249512 |
aaggtaactggacagggagctccactgtctttgacaatcggtaaacattgctaactgtgtaaccttttccgtcgtaagttttgtcttttattttcaaaat |
1249611 |
T |
 |
| Q |
101 |
cggtaaacattgctaactgtataggcatggtttacctatggagtcttccttaaactgtgtgttgtgtgaggggattttggaaccgacaaaccatttgctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1249612 |
cggtaaacattgctaactgtataggcatggtttacctctggagtcttccttaaactgtgtgttgtgtgaggggattttggaaccgacaaaccatttgctt |
1249711 |
T |
 |
| Q |
201 |
cttcgctgtgtgtttgctaaaggggtg |
227 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
1249712 |
cttcgctgtgtgtttgctaaagtggtg |
1249738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University