View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3710_high_54 (Length: 341)
Name: NF3710_high_54
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3710_high_54 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 33500649 - 33500885
Alignment:
| Q |
1 |
tttcaaagttgtccacaagcacataaagtcattctatttagaagaaacaagaaacaaatcagtccctctaagatgacagagaaatctgtgtcactgtgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33500649 |
tttcaaagttgtccacaagcacataaagtcattctatttagaagaaacaagaaacaaatcagtccctctaagatgacagagaaatctgtgtcaccgtgtg |
33500748 |
T |
 |
| Q |
101 |
tcaagtacatagttgaatatttaagggggttcaaagtagaaaagaaaaattgattaaaataagaacgttcnnnnnnncaccagctgacgatattttggag |
200 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| | |||||||||||||||||| ||| ||||||| ||||||||||| |
|
|
| T |
33500749 |
tcaagtacatagttgaaaatttaagggggttcaaagtagaaaagaaaaaattattaaaataagaacgttctttttttcacaagctgacaatattttggag |
33500848 |
T |
 |
| Q |
201 |
tagtttataacattttttaaggttgctatttaagtag |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33500849 |
tagtttataacattttttaaggttgctatttaagtag |
33500885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 272 - 323
Target Start/End: Original strand, 33500920 - 33500971
Alignment:
| Q |
272 |
catgaaccaacaacaaacaaatgtgaggctcatagcaccgataagattgaat |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33500920 |
catgaaccaacaacaaacaaatgtgaggctcataacaccgataagattgaat |
33500971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University