View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3710_high_70 (Length: 298)
Name: NF3710_high_70
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3710_high_70 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 16 - 281
Target Start/End: Original strand, 3049375 - 3049640
Alignment:
| Q |
16 |
atcaagaagattcaattccagaatctaagcaacaaaatgaagaaagaaagtcaaagggtgttaggatatggaagtgtttttgtattccaagtgaatggtt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3049375 |
atcaagaagattcaattccagaatctaagcaacaaaatgaagaaagaaagtcaaagggtgttaggatatggaagtgtttttgtattccaagtgaatggtt |
3049474 |
T |
 |
| Q |
116 |
taaaatgctatcaagagaaatgcattggagttttgtttttggagttgttgttgtttatggaataagtcaaggtttaggtggtgctcttgctggtgttgga |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3049475 |
taaaatgctatcaagagaaatgcattggagttttgtttttggagttgttgttgtttatggaataagtcaaggtttaggtggtgctcttgctggtgttgga |
3049574 |
T |
 |
| Q |
216 |
acaaaatattatatgaaagatgttcagaaagttcaaccttctgaagcacaggtttatgctggaatt |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3049575 |
acaaaatattatatgaaagatgttcagaaagttcaaccttctgaagcacaggtttatgctggaatt |
3049640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University