View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3710_high_82 (Length: 272)
Name: NF3710_high_82
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3710_high_82 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 9e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 9e-79
Query Start/End: Original strand, 10 - 178
Target Start/End: Original strand, 1709192 - 1709360
Alignment:
| Q |
10 |
aagaatatacgaagtggttcgatcgttaactgagaagattatcgacgataatcacctcgacggtgttcattcgttatgtgaggttaaccgtgttgctttg |
109 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1709192 |
aagaaaatacgaagttgttcgatcgttaactgagaagattatcgacgataatcacctcgatggtgttcattcgttacgtgaggttaaccgtgttgctttg |
1709291 |
T |
|
| Q |
110 |
tcttcagcgtttgggagggcgttgcggcagttggaagtgaaggttgcggagagagatcaaggagaaggc |
178 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1709292 |
tcttcagcgtttgggagggcgttggggcagttggaagtgaaggttgcggagagagatcaaggagaaggc |
1709360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University