View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3710_high_90 (Length: 257)
Name: NF3710_high_90
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3710_high_90 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 22 - 117
Target Start/End: Complemental strand, 7832840 - 7832745
Alignment:
| Q |
22 |
ttgaaggccatcccttcaagctttgaagttcacatcttactggttgtgtctcgacttcatattgttgtgtcttctttgattactggttagtgttca |
117 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7832840 |
ttgaaggccattccttcaagctttgaagttcacatcttactggctgtgtctcgacttcatattgttgtgtcttctttgattacttgttagtgttca |
7832745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 164 - 239
Target Start/End: Complemental strand, 7832698 - 7832623
Alignment:
| Q |
164 |
aaaaatgatcaggactgggttttcatggtagtaatgcttgctttgccgccgtgagtggtggttcttccatgttgtt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7832698 |
aaaaatgatcaggactgggttttcatggtagtaatgcttgctttgccgccgtgagtggtggttcttccatgttgtt |
7832623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University