View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3710_high_92 (Length: 251)
Name: NF3710_high_92
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3710_high_92 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 154
Target Start/End: Original strand, 1249922 - 1250093
Alignment:
| Q |
1 |
ttggggttggaacccgggagattgtctcatgcgttagtgttact--ttttgcgcttaggaggttgaggctggggtatgctttggtttgctgcttcct--- |
95 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1249922 |
ttggggatggaacccgggagattgtctcatgcgttagtgttactgtttttgcgcttaggaggttgaggctggggtatgctttggtttgctgcttcctgct |
1250021 |
T |
|
| Q |
96 |
-------------gctttttggtatatggcggcctcaatttcttgacagtagccgctaggaggttctgatta |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1250022 |
ttctggtatgctggctttttggtatatggcggcctcaatttcttgacagtagctgctaggaggttctgatta |
1250093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 199 - 235
Target Start/End: Original strand, 1250138 - 1250174
Alignment:
| Q |
199 |
acggcagaagggtttctggtatatgagtgccctatgt |
235 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |
|
|
| T |
1250138 |
acggcagaagggtttctggtatatgagtaccctatgt |
1250174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University