View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3710_high_96 (Length: 249)
Name: NF3710_high_96
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3710_high_96 |
 |  |
|
| [»] scaffold0328 (1 HSPs) |
 |  |  |
|
| [»] scaffold0102 (1 HSPs) |
 |  |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |  |
|
| [»] scaffold0576 (1 HSPs) |
 |  |  |
|
| [»] scaffold0217 (1 HSPs) |
 |  |  |
|
| [»] scaffold0051 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 85; Significance: 1e-40; HSPs: 15)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 147 - 239
Target Start/End: Original strand, 39079277 - 39079369
Alignment:
| Q |
147 |
aaaagaattggtgcaagaatgtatccaagaaatttataactgccatgctttttgtttttgttcgtgtgtcgtggtgaccttgagtagtctgtg |
239 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39079277 |
aaaagaattggtgcaagaatatatccaagaaatttataactgccatggtttttgtttttgttcgtgtgtcgtggtgaccttgagtagtctgtg |
39079369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 23734248 - 23734313
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| |||||||||| ||||| ||||||||||||||| |||| ||||||| |||||| ||||| |
|
|
| T |
23734248 |
ccccgcaagtgggcggtgaaattggtcccctcagattagtcgattcttgaatcggataccaagttt |
23734313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 23741440 - 23741505
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| |||||||||| ||||| ||||||||||||||| |||| ||||||| |||||| ||||| |
|
|
| T |
23741440 |
ccccgcaagtgggcggtgaaattggtcccctcagattagtcgattcttgaatcggataccaagttt |
23741505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 4621303 - 4621238
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
4621303 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
4621238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 7766793 - 7766728
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||||||| |||| ||||||| |
|
|
| T |
7766793 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttgaatcggatatcgagttt |
7766728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 8254818 - 8254753
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| ||||||||||| |||||| |||| ||||||| |||||||||||| |
|
|
| T |
8254818 |
ccccgcaagtgggcggtgggattgatccccttgaattagtcgattcttgaatcggataccgagttt |
8254753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 27454930 - 27454865
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||||||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||| ||||| |
|
|
| T |
27454930 |
ccccgcatgtgggcggtgggattggtcccctcggattagtcgattcttggatcggatacctagttt |
27454865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 45331687 - 45331622
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| |||| |||||| ||| |||||||||||||| | |||| ||||||| |||||||||||| |
|
|
| T |
45331687 |
ccccgcaagtggacggtgggattaatcccctcagattaatcgattcttgaatcggataccgagttt |
45331622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 89
Target Start/End: Original strand, 24122155 - 24122219
Alignment:
| Q |
25 |
cccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
|||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
24122155 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
24122219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 89
Target Start/End: Original strand, 7578543 - 7578605
Alignment:
| Q |
27 |
cgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
|||| ||||| ||||| |||| | ||||| |||||||||||||||| ||| |||||||||||| |
|
|
| T |
7578543 |
cgcaagtgggtggtgggattggttccctcggattagttgatttttggatcggataccgagttt |
7578605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 85
Target Start/End: Original strand, 6776211 - 6776272
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccga |
85 |
Q |
| |
|
||||||| || ||||||||||||||||| ||||||||||| |||| ||| ||| ||||||| |
|
|
| T |
6776211 |
ccccgcaagtaggcggtggaattgatccactcagattagtcgattattgtatcgaataccga |
6776272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 27159216 - 27159281
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| |||| |||||| |||| ||||||||||||||| ||| |||| ||| |||| ||||||| |
|
|
| T |
27159216 |
ccccgcaagtggacggtgggattggtcccctcagattagtcgatctttggatcggatatcgagttt |
27159281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 3 - 63
Target Start/End: Original strand, 30677285 - 30677346
Alignment:
| Q |
3 |
ttgcattggctttaaatgaaacccc-gcatgtgggcggtggaattgatcccctcagattagt |
63 |
Q |
| |
|
|||| ||||||||||||| ||||| ||| ||||||||||| |||| ||||||||||||||| |
|
|
| T |
30677285 |
ttgctttggctttaaatgggacccccgcaagtgggcggtgggattggtcccctcagattagt |
30677346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 32729675 - 32729740
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| ||||||||||| ||||||| | | |||| ||| |||||||||||| |
|
|
| T |
32729675 |
ccccgcaagtgggcggtgggattgatccccttggattagtcggtctttggatcggataccgagttt |
32729740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 36155954 - 36155889
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| |||| ||| |||||| |||| ||| ||| |||||||||||| |
|
|
| T |
36155954 |
ccccgcaggtgggcggtgggattggtcccttcaaattagtcgattcttggatcggataccgagttt |
36155889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 77; Significance: 8e-36; HSPs: 12)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 147 - 239
Target Start/End: Original strand, 2322951 - 2323043
Alignment:
| Q |
147 |
aaaagaattggtgcaagaatgtatccaagaaatttataactgccatgctttttgtttttgttcgtgtgtcgtggtgaccttgagtagtctgtg |
239 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2322951 |
aaaagaattggtgcaaatatatatccaagaaatttataactgccatgatttttgtttttgttcgtgtgtcgtggtgaccttgagtagtctgtg |
2323043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 21148577 - 21148512
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||||||| |||||||||||| |
|
|
| T |
21148577 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttgaatcggataccgagttt |
21148512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 24 - 90
Target Start/End: Original strand, 9239106 - 9239172
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttta |
90 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| ||||||||||||| |
|
|
| T |
9239106 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttta |
9239172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 27 - 89
Target Start/End: Original strand, 28672201 - 28672263
Alignment:
| Q |
27 |
cgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
|||| ||||||||||| |||| ||||||| ||||||| |||| ||| |||||||||||||||| |
|
|
| T |
28672201 |
cgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcagataccgagttt |
28672263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 3222702 - 3222637
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
3222702 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
3222637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 11449002 - 11449067
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||||||| |||| ||||||| |
|
|
| T |
11449002 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttgaatcggatatcgagttt |
11449067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 34147477 - 34147542
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
34147477 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
34147542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 34160093 - 34160158
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
34160093 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
34160158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 89
Target Start/End: Complemental strand, 654211 - 654147
Alignment:
| Q |
25 |
cccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
|||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
654211 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattattggatcggataccgagttt |
654147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 9208383 - 9208448
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| || ||||||| |||| |||| ||| |||| ||||||||||| |
|
|
| T |
9208383 |
ccccgcaagtgggcggtgggattggtctcctcagaatagtcgattcttggatcaaataccgagttt |
9208448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 15360164 - 15360099
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| |||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
15360164 |
ccccgcaaatgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
15360099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 54 - 90
Target Start/End: Complemental strand, 8051612 - 8051576
Alignment:
| Q |
54 |
tcagattagttgatttttgaatcagataccgagttta |
90 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||| |
|
|
| T |
8051612 |
tcagattagttggttcttgaatcagataccgagttta |
8051576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 51; Significance: 2e-20; HSPs: 23)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 3 - 89
Target Start/End: Original strand, 27704115 - 27704201
Alignment:
| Q |
3 |
ttgcattggctttaaatgaaaccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
|||| ||||||||||||| | ||||||| ||||| |||| |||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
27704115 |
ttgctttggctttaaatggacccccgcaagtgggtggtgtgattgatcccctcagattagtcgattcttgaatcagataccgagttt |
27704201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 3851892 - 3851957
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||||||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
3851892 |
ccccgcaagtgggcggtgggattgatcccctcggattagtcgattcttggatcggataccgagttt |
3851957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 32 - 89
Target Start/End: Complemental strand, 21217891 - 21217834
Alignment:
| Q |
32 |
gtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||| ||| ||| |||||||||||| |
|
|
| T |
21217891 |
gtgggcggtgggattgatcccctcggattagttgattcttggatcggataccgagttt |
21217834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 27312287 - 27312352
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||||||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
27312287 |
ccccgcaagtgggcggtgggattggtcccctcagattagtcgattcttggatcggataccgagttt |
27312352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 32 - 90
Target Start/End: Original strand, 19421374 - 19421432
Alignment:
| Q |
32 |
gtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttta |
90 |
Q |
| |
|
||||||||||| |||| || |||| ||||||| |||| ||||||||||||||||||||| |
|
|
| T |
19421374 |
gtgggcggtgggattggtctcctcggattagtcgattcttgaatcagataccgagttta |
19421432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 7275412 - 7275477
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
7275412 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
7275477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 10091323 - 10091387
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||||||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
10091323 |
ccccgcaagtgggcggtgggattgatcccctcggattagtcgattcttg-atccgataccgagttt |
10091387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 32 - 89
Target Start/End: Original strand, 18044250 - 18044307
Alignment:
| Q |
32 |
gtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||| |||||||||| ||||||||||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
18044250 |
gtgggtggtggaattggtcccctcagattagtcgattcttggatcggataccgagttt |
18044307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 22120023 - 22120088
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
22120023 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
22120088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 40542976 - 40542911
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
40542976 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
40542911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 89
Target Start/End: Complemental strand, 31712965 - 31712903
Alignment:
| Q |
27 |
cgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
|||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
31712965 |
cgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
31712903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 32 - 90
Target Start/End: Original strand, 32849734 - 32849792
Alignment:
| Q |
32 |
gtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttta |
90 |
Q |
| |
|
|||||| |||| |||| ||||||||||||||| |||| ||| ||| ||||||||||||| |
|
|
| T |
32849734 |
gtgggcagtgggattggtcccctcagattagtcgattcttggatcggataccgagttta |
32849792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 654771 - 654706
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| | || ||| ||| |||||||||||| |
|
|
| T |
654771 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcggttcttggatcggataccgagttt |
654706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 2751406 - 2751471
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| |||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
2751406 |
ccccgcaaatgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
2751471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 7175928 - 7175863
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| ||||| |||||| |
|
|
| T |
7175928 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggatactgagttt |
7175863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 11997984 - 11998049
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| |||||| |||| ||| ||| |||||||||||| |
|
|
| T |
11997984 |
ccccgcaagtgggcggtgggattggtcccctcgaattagtcgattcttggatcggataccgagttt |
11998049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 17197016 - 17196951
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| |||||| |||| ||| ||| |||||||||||| |
|
|
| T |
17197016 |
ccccgcaagtgggcggtgggattggtcccctcgaattagtcgattcttggatcggataccgagttt |
17196951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 21835286 - 21835351
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||| ||||||| |
|
|
| T |
21835286 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggatatcgagttt |
21835351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 29861805 - 29861870
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||||||||||| |||||| |||| || ||| |||||||||||| |
|
|
| T |
29861805 |
ccccgcaagtgggcggtgggattgatcccctcgaattagtcgattcttagatcggataccgagttt |
29861870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 31197725 - 31197790
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| |||| |||||| |||| ||||||||||||||| |||| ||| ||| |||| ||||||| |
|
|
| T |
31197725 |
ccccgcaagtggtcggtgggattggtcccctcagattagtcgattcttggatcggatatcgagttt |
31197790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 42913579 - 42913514
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| |||| |||||| |||| ||||||| |||||||||||| || ||| |||||||||||| |
|
|
| T |
42913579 |
ccccgcaagtggacggtgggattggtcccctcggattagttgattcttagatcggataccgagttt |
42913514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 26 - 90
Target Start/End: Original strand, 22638425 - 22638489
Alignment:
| Q |
26 |
ccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttta |
90 |
Q |
| |
|
||||| ||||||||||| ||||||| |||| |||||| |||| ||| ||| ||||||||||||| |
|
|
| T |
22638425 |
ccgcaagtgggcggtgggattgatctcctcgaattagtcgattcttggatcggataccgagttta |
22638489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 9 - 89
Target Start/End: Original strand, 28089939 - 28090019
Alignment:
| Q |
9 |
tggctttaaatgaaaccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
|||||||||||| ||||||| ||||||| || |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
28089939 |
tggctttaaatgggcccccgcaagtgggcgatgagattggtcccctcggattagtcgattcttggatcggataccgagttt |
28090019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 2e-17; HSPs: 19)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 22392819 - 22392884
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||| |||||||| ||| |||||||||||| |
|
|
| T |
22392819 |
ccccgcaagtgggcggtggaattggtcccctcagattagtcgatttttggatcggataccgagttt |
22392884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 7085692 - 7085627
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||||||| |||||||||||| |
|
|
| T |
7085692 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttgaatcggataccgagttt |
7085627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 21236428 - 21236363
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| ||| ||||||||||||||| |||| ||||||| |||||||||||| |
|
|
| T |
21236428 |
ccccgcaagtgggcggtgggattagtcccctcagattagtcgattcttgaatcggataccgagttt |
21236363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 9 - 89
Target Start/End: Complemental strand, 19145493 - 19145413
Alignment:
| Q |
9 |
tggctttaaatgaaaccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||| |||| ||||||| ||||||||| || ||| ||| |||||||||||| |
|
|
| T |
19145493 |
tggctttaaatggtcccccgcaagtgggcggtgggattggtcccctcggattagttggttcttggatcggataccgagttt |
19145413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 8484727 - 8484662
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
8484727 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
8484662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 18207338 - 18207403
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
18207338 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
18207403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 19456277 - 19456212
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
19456277 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
19456212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 22693066 - 22693131
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
22693066 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
22693131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 27498797 - 27498732
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
27498797 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
27498732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 12 - 89
Target Start/End: Complemental strand, 41568947 - 41568870
Alignment:
| Q |
12 |
ctttaaatgaaaccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||||| ||||||||| |||| ||||| |||| |||||| ||||||||||||| || |||||||| ||||||| |
|
|
| T |
41568947 |
ctttaaatggaaccccgcaaatgggtggtgggattggtcccctaagattagttgattattcgatcagatatcgagttt |
41568870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 89
Target Start/End: Original strand, 37495186 - 37495250
Alignment:
| Q |
25 |
cccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
|||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
37495186 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
37495250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 26 - 89
Target Start/End: Complemental strand, 41351168 - 41351105
Alignment:
| Q |
26 |
ccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
41351168 |
ccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
41351105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 11926567 - 11926502
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||| ||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
11926567 |
ccccgcaagtgggtggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
11926502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 85
Target Start/End: Complemental strand, 13659311 - 13659250
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccga |
85 |
Q |
| |
|
||||||| ||||||||||| |||||||||||| ||||| | |||| ||| ||| |||||||| |
|
|
| T |
13659311 |
ccccgcaagtgggcggtgggattgatcccctcggattaatcgattcttggatcggataccga |
13659250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 15641171 - 15641107
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
15641171 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttg-atcggataccgagttt |
15641107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 30485959 - 30486024
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| ||| ||| ||| |||||||||||| |
|
|
| T |
30485959 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcaattcttggatcggataccgagttt |
30486024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 38631045 - 38630980
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||| | |||| ||| ||| |||||||||||| |
|
|
| T |
38631045 |
ccccgcaagtgggcggtgggattggtcccctcggattaatcgattcttggatcggataccgagttt |
38630980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 90
Target Start/End: Original strand, 22648167 - 22648219
Alignment:
| Q |
38 |
ggtggaattgatcccctcagattagttgatttttgaatcagataccgagttta |
90 |
Q |
| |
|
||||| |||||||||||||||||||| | | |||| ||| ||||||||||||| |
|
|
| T |
22648167 |
ggtgggattgatcccctcagattagtcggtctttggatcggataccgagttta |
22648219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 37 - 89
Target Start/End: Complemental strand, 28614539 - 28614487
Alignment:
| Q |
37 |
cggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
|||||| |||||||||||| |||||| |||||||| ||| |||||||||||| |
|
|
| T |
28614539 |
cggtgggattgatcccctcgaattagtcgatttttggatcggataccgagttt |
28614487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0328 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0328
Description:
Target: scaffold0328; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 13113 - 13048
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| |||| |||||| ||||||||||||||||||||||||| ||| ||| |||||||||||| |
|
|
| T |
13113 |
ccccgcaagtggacggtgggattgatcccctcagattagttgattcttggatcggataccgagttt |
13048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 12)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 9 - 89
Target Start/End: Original strand, 2166816 - 2166896
Alignment:
| Q |
9 |
tggctttaaatgaaaccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||||||| | |||||||| ||||||||||| |||| ||||||||||||||| ||||||| || |||||||||||| |
|
|
| T |
2166816 |
tggctttaaataagaccccgcaagtgggcggtgggattggtcccctcagattagtcgattttttgattggataccgagttt |
2166896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 2639477 - 2639412
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
2639477 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
2639412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 4718780 - 4718845
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
4718780 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
4718845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 9 - 90
Target Start/End: Complemental strand, 7558032 - 7557951
Alignment:
| Q |
9 |
tggctttaaatgaaaccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttta |
90 |
Q |
| |
|
|||||||||| | | ||||||| |||| |||||| |||| ||||||| |||||| |||||||| ||| ||||||||||||| |
|
|
| T |
7558032 |
tggctttaaacggacccccgcaagtggacggtgggattggtcccctcgaattagtcgatttttgcatcggataccgagttta |
7557951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 21603365 - 21603430
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
21603365 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
21603430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 39349391 - 39349456
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||||||||||| ||||||| |||| ||| ||| |||||| ||||| |
|
|
| T |
39349391 |
ccccgcaagtgggcggtgggattgatcccctcggattagtcgattcttggatcggataccaagttt |
39349456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 42643184 - 42643119
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||||||| ||| ||| |||||||||||| |
|
|
| T |
42643184 |
ccccgcaagtgggcggtgggattggtcccctcgcattagttgattcttggatcggataccgagttt |
42643119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 89
Target Start/End: Complemental strand, 8765591 - 8765527
Alignment:
| Q |
25 |
cccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
|||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
8765591 |
cccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
8765527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 89
Target Start/End: Original strand, 25248485 - 25248546
Alignment:
| Q |
27 |
cgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
|||| ||||||||||| |||| ||||||| ||||||| |||||||| ||| |||||||||||| |
|
|
| T |
25248485 |
cgcaagtgggcggtgggattggtcccctcggattagtcgatttttg-atcggataccgagttt |
25248546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 32 - 90
Target Start/End: Original strand, 28193617 - 28193675
Alignment:
| Q |
32 |
gtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttta |
90 |
Q |
| |
|
||||||||||| |||| ||||||| ||||||| |||| ||| ||| ||||||||||||| |
|
|
| T |
28193617 |
gtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttta |
28193675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 2618321 - 2618386
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| ||| |||||||| |
|
|
| T |
2618321 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggattccgagttt |
2618386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 34237721 - 34237656
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||| ||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
34237721 |
ccccgcaagtgagcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
34237656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0102 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0102
Description:
Target: scaffold0102; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 39223 - 39288
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| |||||||||||||||| |
|
|
| T |
39223 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcagataccgagttt |
39288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 161940 - 162005
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| |||||||||||||||| |
|
|
| T |
161940 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcagataccgagttt |
162005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 38; Significance: 0.000000000001; HSPs: 13)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 19660598 - 19660533
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||||||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
19660598 |
ccccgcaagtgggcggtgggattgatcccctcggattagtcgattcttggatcggataccgagttt |
19660533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 5609268 - 5609203
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| |||| |||||| |||||||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
5609268 |
ccccgcaagtggacggtgggattgatcccctcggattagtcgattcttggatcggataccgagttt |
5609203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 34844824 - 34844759
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
34844824 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
34844759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 40058918 - 40058853
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
40058918 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
40058853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 46714524 - 46714589
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| ||| ||||||| |||||||||||| |
|
|
| T |
46714524 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcaattcttgaatcggataccgagttt |
46714589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 52983750 - 52983815
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
52983750 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
52983815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 89
Target Start/End: Original strand, 44343646 - 44343710
Alignment:
| Q |
25 |
cccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
|||||| ||||||||||| |||| ||||||| |||||| |||| ||||||| |||||||||||| |
|
|
| T |
44343646 |
cccgcaagtgggcggtgggattggtcccctcgaattagtcgattcttgaatcggataccgagttt |
44343710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 39 - 89
Target Start/End: Complemental strand, 18875568 - 18875518
Alignment:
| Q |
39 |
gtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
|||| |||||||||||| ||||||| ||||||| |||||||||||||||| |
|
|
| T |
18875568 |
gtgggattgatcccctcggattagtcaatttttggatcagataccgagttt |
18875518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 9978575 - 9978510
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| |||| || |||||||||||| || ||| |||||||||||| |
|
|
| T |
9978575 |
ccccgcaagtgggcggtgggattggtcccatcggattagttgattcttagatcggataccgagttt |
9978510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 20566481 - 20566546
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||| ||| |||| ||||||||||||||| |||| ||| ||| |||| ||||||| |
|
|
| T |
20566481 |
ccccgcaagtgggcgctgggattggtcccctcagattagtcgattcttggatcggatatcgagttt |
20566546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 27528861 - 27528796
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| |||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
27528861 |
ccccgcaagtgggcggtgagattggtcccctcggattagtcgattcttggatcggataccgagttt |
27528796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 32986328 - 32986393
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| || |||| |||| ||| ||| |||||||||||| |
|
|
| T |
32986328 |
ccccgcaagtgggcggtgggattggtcccctcggaatagtcgattcttggatcggataccgagttt |
32986393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 32 - 89
Target Start/End: Complemental strand, 36131568 - 36131511
Alignment:
| Q |
32 |
gtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||||||| |||| ||||||| ||||||| |||| || |||||||||||||||| |
|
|
| T |
36131568 |
gtgggcggtgggattggtcccctcggattagtcgattattagatcagataccgagttt |
36131511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 24)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 15566566 - 15566501
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||||||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
15566566 |
ccccgcaagtgggcggtgggattggtcccctcagattagtcgattcttggatcggataccgagttt |
15566501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 1692964 - 1693029
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| ||| |||||||||||||| |||| ||||||| |||||||||||| |
|
|
| T |
1692964 |
ccccgcaagtgggcggtgggatttgccccctcagattagtcgattcttgaatcggataccgagttt |
1693029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 8097345 - 8097280
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
8097345 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
8097280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 8456216 - 8456151
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| |||||| |||| |||| ||||||| ||||||| |||| ||||||| |||||||||||| |
|
|
| T |
8456216 |
ccccgcaagtgggcagtgggattggtcccctcggattagtcgattcttgaatcggataccgagttt |
8456151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 8958101 - 8958036
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||| | |||| ||| |||||||||||||||| |
|
|
| T |
8958101 |
ccccgcaagtgggcggtgggattggtcccctctgattaatcgattcttggatcagataccgagttt |
8958036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 24165781 - 24165716
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
24165781 |
ccccgcaagtgggcggtgggattgttcccctcggattagtcgattcttggatcggataccgagttt |
24165716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 26174244 - 26174309
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
26174244 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
26174309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 34492641 - 34492576
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||| ||||||||||||||| ||| ||| |||||||||||| |
|
|
| T |
34492641 |
ccccgcaagtgggcggtgggattggtccattcagattagttgattcttggatctgataccgagttt |
34492576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 45272482 - 45272417
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| |||||||||| | ||| ||| |||||||||||| |
|
|
| T |
45272482 |
ccccgcaagtgggcggtgggattggtcccctcggattagttgactcttggatcggataccgagttt |
45272417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 53848500 - 53848435
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
53848500 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
53848435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 26 - 89
Target Start/End: Original strand, 54475814 - 54475877
Alignment:
| Q |
26 |
ccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||| ||||||||||| |||| |||||| ||||||| |||| ||| |||||||||||||||| |
|
|
| T |
54475814 |
ccgcaagtgggcggtgggattggtccccttggattagtcgattcttggatcagataccgagttt |
54475877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 27 - 89
Target Start/End: Original strand, 24407395 - 24407457
Alignment:
| Q |
27 |
cgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
|||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
24407395 |
cgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
24407457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 32 - 89
Target Start/End: Original strand, 4048089 - 4048146
Alignment:
| Q |
32 |
gtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
|||| |||||| |||| ||||||| |||||||||||| ||| ||| |||||||||||| |
|
|
| T |
4048089 |
gtggacggtgggattggtcccctcggattagttgattcttggatcggataccgagttt |
4048146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 7195938 - 7196003
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
|||| ||||||||| |||| |||| ||||||||||||||| |||| || || ||||||||||||| |
|
|
| T |
7195938 |
ccccacatgtgggcagtgggattggtcccctcagattagtcgattctttgattagataccgagttt |
7196003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 10190808 - 10190743
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| |||| |||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
10190808 |
ccccgcaagtggacggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
10190743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 85
Target Start/End: Original strand, 30257755 - 30257816
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccga |
85 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||| |
|
|
| T |
30257755 |
ccccgcaagtgggcggtggcattggtcccctcggattagtcgattcttggatcggataccga |
30257816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 40133515 - 40133450
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| |||||| |||| ||| ||| |||||||||||| |
|
|
| T |
40133515 |
ccccgcaagtgggcggtgggattggtcccctcgaattagtcgattcttggatcggataccgagttt |
40133450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 45529820 - 45529756
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
45529820 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttg-atcggataccgagttt |
45529756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 32 - 89
Target Start/End: Complemental strand, 49258320 - 49258263
Alignment:
| Q |
32 |
gtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
49258320 |
gtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
49258263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 32 - 89
Target Start/End: Complemental strand, 50731295 - 50731238
Alignment:
| Q |
32 |
gtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||| ||| ||| |||||||||||| |
|
|
| T |
50731295 |
gtgggcggtgggattggtcccctcagattagtcgatccttggatcggataccgagttt |
50731238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 32 - 89
Target Start/End: Original strand, 50781559 - 50781616
Alignment:
| Q |
32 |
gtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||||||| |||| ||||||||||||||| ||| ||| ||| |||||||||||| |
|
|
| T |
50781559 |
gtgggcggtgggattggtcccctcagattagtcgatccttggatcggataccgagttt |
50781616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 32 - 89
Target Start/End: Complemental strand, 52821694 - 52821637
Alignment:
| Q |
32 |
gtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
52821694 |
gtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
52821637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 53233976 - 53233912
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
53233976 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttg-atcggataccgagttt |
53233912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 53424243 - 53424178
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||| ||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
53424243 |
ccccgcaagtgagcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
53424178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000001; HSPs: 11)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 15038090 - 15038155
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||||||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
15038090 |
ccccgcaagtgggcggtgggattggtcccctcagattagtcgattcttggatcggataccgagttt |
15038155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 3 - 89
Target Start/End: Original strand, 19054134 - 19054222
Alignment:
| Q |
3 |
ttgcattggctttaaatgaaacccc--gcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
|||| ||||||||||||| |||||| ||| ||||||||||| |||| ||| ||| ||||||| |||| ||| |||||||||||||||| |
|
|
| T |
19054134 |
ttgctttggctttaaatggaaccccccgcaagtgggcggtgggattggtccgctcggattagtcgattcttggatcagataccgagttt |
19054222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 35171931 - 35171996
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||||||| |||||||||||| |
|
|
| T |
35171931 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttgaatcggataccgagttt |
35171996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 2140552 - 2140487
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
2140552 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattattggatcggataccgagttt |
2140487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 11941276 - 11941211
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
11941276 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
11941211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 32 - 89
Target Start/End: Original strand, 28669012 - 28669069
Alignment:
| Q |
32 |
gtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||||||| |||| ||||||| ||||||| |||||||| ||| |||||||||||| |
|
|
| T |
28669012 |
gtgggcggtgggattggtcccctcggattagtcgatttttggatcggataccgagttt |
28669069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 44946119 - 44946054
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
44946119 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
44946054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 89
Target Start/End: Complemental strand, 27269409 - 27269345
Alignment:
| Q |
25 |
cccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
|||||| ||||||||||| |||||||||||| ||||||| |||| ||| || |||||||||||| |
|
|
| T |
27269409 |
cccgcaagtgggcggtgggattgatcccctcggattagtcgattcttggataggataccgagttt |
27269345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 24196133 - 24196198
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| ||||||| || |||||||||||| |
|
|
| T |
24196133 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattttttgattggataccgagttt |
24196198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Original strand, 25293290 - 25293355
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||| ||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
25293290 |
ccccgcaagtgggcgatgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
25293355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 38784247 - 38784182
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| |||| ||||| ||||||||| ||||||||||||||| || |||| ||||||||||| |
|
|
| T |
38784247 |
ccccgcaagtggacggtgagattgatcccttcagattagttgattcttagatcaaataccgagttt |
38784182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0576 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0576
Description:
Target: scaffold0576; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 5148 - 5083
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| |||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||||||||| |
|
|
| T |
5148 |
ccccgcaaatgggcggtgggattggtcccctcggattagtcgattcttggatcggataccgagttt |
5083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0217 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0217
Description:
Target: scaffold0217; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 7375 - 7310
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||||| |||| ||||||| ||||||| |||| ||| ||| |||||| ||||| |
|
|
| T |
7375 |
ccccgcaagtgggcggtgggattggtcccctcggattagtcgattcttggatcggataccaagttt |
7310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0051 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 24 - 89
Target Start/End: Complemental strand, 52937 - 52872
Alignment:
| Q |
24 |
ccccgcatgtgggcggtggaattgatcccctcagattagttgatttttgaatcagataccgagttt |
89 |
Q |
| |
|
||||||| ||||||||| | |||| ||| ||| ||||||| |||| ||||||| |||||||||||| |
|
|
| T |
52937 |
ccccgcaggtgggcggtaggattggtcctctcggattagtcgattcttgaatcggataccgagttt |
52872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University