View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3710_low_104 (Length: 247)

Name: NF3710_low_104
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3710_low_104
NF3710_low_104
[»] chr5 (4 HSPs)
chr5 (24-95)||(34281047-34281118)
chr5 (35-101)||(34289733-34289799)
chr5 (35-103)||(34302118-34302186)
chr5 (192-228)||(34281002-34281038)


Alignment Details
Target: chr5 (Bit Score: 68; Significance: 2e-30; HSPs: 4)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 24 - 95
Target Start/End: Complemental strand, 34281118 - 34281047
Alignment:
24 tgagcttaatggattacttacttcctccttcgtgaggagaccttaaggaagatgagcattaatttacttaaa 95  Q
    ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
34281118 tgagcttaatggattacttacttcctcattcgtgaggagaccttaaggaagatgagcattaatttacttaaa 34281047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 35 - 101
Target Start/End: Complemental strand, 34289799 - 34289733
Alignment:
35 gattacttacttcctccttcgtgaggagaccttaaggaagatgagcattaatttacttaaagatgac 101  Q
    ||||||||||||||||||||||| |||| ||||||| ||||||||||| ||||||||||||||||||    
34289799 gattacttacttcctccttcgtggggaggccttaagaaagatgagcatcaatttacttaaagatgac 34289733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 35 - 103
Target Start/End: Complemental strand, 34302186 - 34302118
Alignment:
35 gattacttacttcctccttcgtgaggagaccttaaggaagatgagcattaatttacttaaagatgacgt 103  Q
    ||||||||||||||||||||||| |||||| ||||| |||||||| || ||||||||||||| ||||||    
34302186 gattacttacttcctccttcgtggggagacgttaagaaagatgagtatcaatttacttaaaggtgacgt 34302118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 192 - 228
Target Start/End: Complemental strand, 34281038 - 34281002
Alignment:
192 aattacgcaatgcatctatataatcctaattaatccc 228  Q
    |||||||||||||||||||||||||||||||||||||    
34281038 aattacgcaatgcatctatataatcctaattaatccc 34281002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University