View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3710_low_106 (Length: 241)
Name: NF3710_low_106
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3710_low_106 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 78 - 241
Target Start/End: Original strand, 10298486 - 10298649
Alignment:
| Q |
78 |
actttcacacctatattaaattctttcaaaaaggaaaagcattttgtgcatttcctagagatgagtatttcatttcaatacaaagaannnnnnnattgag |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10298486 |
actttcacacctatattaaattctttcaaaaaggaaaagcattttgtgcatttcctagagatgagtatttcatttcaatacaaagaatttttttattgag |
10298585 |
T |
|
| Q |
178 |
acgggatgataagacagagtcaatatataatacggatctttcatgcagttccatcaatgattca |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10298586 |
acgggatgataagacagagtcaatatataatacggatctttcatgcagttccatcaatgattca |
10298649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 3 - 82
Target Start/End: Original strand, 10298172 - 10298251
Alignment:
| Q |
3 |
atcatgatgagtttcggagtcgcgaaaatccagtaagaactgaatttagtctaaatttggcattcaatgctcaccacttt |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10298172 |
atcatgatgagtttcggagtcgcgaaaatccagtaagaactgaatttagtctaaatttggcattcaatgctcactacttt |
10298251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University