View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3710_low_119 (Length: 233)
Name: NF3710_low_119
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3710_low_119 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 16 - 218
Target Start/End: Complemental strand, 26489776 - 26489574
Alignment:
| Q |
16 |
atgaagtatgtaggaaattgannnnnnnnaatacttacgagtcactaaaagggtagattacataacgtccatcctgtttttccacttcttcttgcaactg |
115 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26489776 |
atgaagtatgtaggaaattgattttttttaatacttacgagtcactaaaaaggtagattacataacgtccatcctgtttttccacttcttcttgaaactg |
26489677 |
T |
 |
| Q |
116 |
atgtgcttgttgcataggatctgcttcctctcgctgttgctgctgctgctcatcgggtactacctcaggcacgatcgaaggttgtgtggtgggaggaggt |
215 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26489676 |
atgtgcttgttgcataggatctgcttcttctcgctgttgctgctgctgctcatcgggtactacctcaggcacgatcgaaggttgtgtggtgggaggaggt |
26489577 |
T |
 |
| Q |
216 |
agt |
218 |
Q |
| |
|
||| |
|
|
| T |
26489576 |
agt |
26489574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University