View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3710_low_127 (Length: 227)
Name: NF3710_low_127
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3710_low_127 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 7 - 227
Target Start/End: Complemental strand, 36671880 - 36671660
Alignment:
| Q |
7 |
tgactgtgtgaaaaagttcactgcagtgaattataattagttttcaatcgagcgggttggttgagtacattgatcagctatattattttatcatataacc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36671880 |
tgactgtgtgaaaaagttcactgcagtgaattataattggttttcaatcgagcgggttggttgagtacattgatcagctatattattttatcatataacc |
36671781 |
T |
 |
| Q |
107 |
cacatgtgtatctatatcaactttgagccatgttgataatttaaattattggtnnnnnnnnnnnnngacaaat---aacattatgcatatcgtccaatag |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
36671780 |
cacatgtgtatctatatcaactttgagccatgttgataatttaaattattggtaaaaaacgaaaaagacaaataacaacattatgcatatcgtccaata- |
36671682 |
T |
 |
| Q |
204 |
ttgttggtgaaagtaaaatccccc |
227 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
36671681 |
--gttggtgaaagtaaaatccccc |
36671660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University