View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3710_low_133 (Length: 213)
Name: NF3710_low_133
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3710_low_133 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 10 - 198
Target Start/End: Original strand, 44976466 - 44976657
Alignment:
| Q |
10 |
agtagcaaaggtgagggaagaatccaaagctgtcatcctcattcattatgaaagtgattttgtcacttggctaagttgcttgcagctgatccatctcttg |
109 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44976466 |
agtagcaaaagtgagggaagaatccaaagctgtcatcctcattcattatgaaagtgattttgtcacttggctaagttgcttgcagctgatccatctcttg |
44976565 |
T |
|
| Q |
110 |
tctgctatgtctgagctatataatgtttgtgttcacgggttcttcatttgtggtg---tcccgtgaacttgctcattttttgggttgaatgt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
44976566 |
tctgctatgtctgagctatataatgtttgtgttcacgggttcttcatttgtggtgtactcccgtgaacttgctcattttttgggttgaatgt |
44976657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University