View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3710_low_43 (Length: 412)
Name: NF3710_low_43
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3710_low_43 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 18 - 347
Target Start/End: Complemental strand, 573593 - 573244
Alignment:
| Q |
18 |
aatatccttacttcactttcatctctcttctcattaaagtannnnnnnnn------acttctactcgcaatctatgaagcataaacatatacaccgaagc |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
573593 |
aatatccttacttcactttcatctctcttctcattaaagtattttttattttttttacttctactcgcaatctatgaagcataaacatatacaccgaagc |
573494 |
T |
 |
| Q |
112 |
attgatatgtctgacact-------------gaaaattatttaagaaaataagataattgaatgaaatcatgcatcgtagtacacacacattcgacttga |
198 |
Q |
| |
|
|||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
573493 |
attgatatgtctgacacttgatattgacactgaaaattatttgagaaaataagataattgaatgaaatcatgcatcgcagtacacacacattcgacttga |
573394 |
T |
 |
| Q |
199 |
aatgtttttggttcattgcttggaaagtagaattttgcttcggtgttgctttatgaaaatttacaaccatggggttgcttctctc-tttatgttccaagt |
297 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
573393 |
aatgtttttggttcattgcttggaaagtagaattttgcttcggtgttgttttatgaaaatttacaaccatggggttgcttctttcttttatgttccaagt |
573294 |
T |
 |
| Q |
298 |
ctttagtttttgtatgtttaaatatgaaatttctttcatgggttgtctca |
347 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
573293 |
ctttagtttttgtatgtttaaatatgaaatttctttcatgggttgtctca |
573244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University