View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3710_low_53 (Length: 354)
Name: NF3710_low_53
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3710_low_53 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 86; Significance: 5e-41; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 118 - 262
Target Start/End: Complemental strand, 1341537 - 1341395
Alignment:
| Q |
118 |
cattgagcagataagtagcaaaaaataaaacgagagatagaaattgacgagtctcctccaatggggactctctaactctttaaagtgtgataagacttca |
217 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||| ||||| || |||||||||||| ||| ||||||||||||| || |||||||||||| | |
|
|
| T |
1341537 |
cattgggcagataaggagcaaaaaataaaacgagagatagagattgatgactctcctccaatgtggagtctctaactctttgaa--gtgataagacttta |
1341440 |
T |
|
| Q |
218 |
aaatacttcccctctctagtgtgaattgaagttaaatctatagag |
262 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
1341439 |
aaatactccccctctcttgtgtgaattgaagttaaatttatagag |
1341395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 16 - 79
Target Start/End: Complemental strand, 1341605 - 1341543
Alignment:
| Q |
16 |
aaggaaaatatggacaaattttcttttgattaaaaaagtaaaccaagcctaatggactgtacaa |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| ||| || ||||||||||||||| |
|
|
| T |
1341605 |
aaggaaaatatggacaaattttcttttgatta-aaaagtaagccatgcttaatggactgtacaa |
1341543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 189 - 262
Target Start/End: Complemental strand, 1333335 - 1333262
Alignment:
| Q |
189 |
ctaactctttaaagtgtgataagacttcaaaatacttcccctctctagtgtgaattgaagttaaatctatagag |
262 |
Q |
| |
|
|||||||||| || ||||||||||||||||||||| ||||||||| |||||||| ||||| |||| ||||||| |
|
|
| T |
1333335 |
ctaactctttgaatggtgataagacttcaaaatactccccctctcttgtgtgaatagaagtcaaatttatagag |
1333262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 14 - 54
Target Start/End: Complemental strand, 1333502 - 1333462
Alignment:
| Q |
14 |
gaaaggaaaatatggacaaattttcttttgattaaaaaagt |
54 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1333502 |
gaaaggaaaacatggacaaattttcttttgattaaaaaagt |
1333462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University