View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3710_low_53 (Length: 354)

Name: NF3710_low_53
Description: NF3710
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3710_low_53
NF3710_low_53
[»] chr6 (4 HSPs)
chr6 (118-262)||(1341395-1341537)
chr6 (16-79)||(1341543-1341605)
chr6 (189-262)||(1333262-1333335)
chr6 (14-54)||(1333462-1333502)


Alignment Details
Target: chr6 (Bit Score: 86; Significance: 5e-41; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 86; E-Value: 5e-41
Query Start/End: Original strand, 118 - 262
Target Start/End: Complemental strand, 1341537 - 1341395
Alignment:
118 cattgagcagataagtagcaaaaaataaaacgagagatagaaattgacgagtctcctccaatggggactctctaactctttaaagtgtgataagacttca 217  Q
    ||||| ||||||||| ||||||||||||||||||||||||| ||||| || |||||||||||| ||| ||||||||||||| ||  |||||||||||| |    
1341537 cattgggcagataaggagcaaaaaataaaacgagagatagagattgatgactctcctccaatgtggagtctctaactctttgaa--gtgataagacttta 1341440  T
218 aaatacttcccctctctagtgtgaattgaagttaaatctatagag 262  Q
    ||||||| ||||||||| ||||||||||||||||||| |||||||    
1341439 aaatactccccctctcttgtgtgaattgaagttaaatttatagag 1341395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 16 - 79
Target Start/End: Complemental strand, 1341605 - 1341543
Alignment:
16 aaggaaaatatggacaaattttcttttgattaaaaaagtaaaccaagcctaatggactgtacaa 79  Q
    |||||||||||||||||||||||||||||||| |||||||| ||| || |||||||||||||||    
1341605 aaggaaaatatggacaaattttcttttgatta-aaaagtaagccatgcttaatggactgtacaa 1341543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 189 - 262
Target Start/End: Complemental strand, 1333335 - 1333262
Alignment:
189 ctaactctttaaagtgtgataagacttcaaaatacttcccctctctagtgtgaattgaagttaaatctatagag 262  Q
    |||||||||| ||  ||||||||||||||||||||| ||||||||| |||||||| ||||| |||| |||||||    
1333335 ctaactctttgaatggtgataagacttcaaaatactccccctctcttgtgtgaatagaagtcaaatttatagag 1333262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 14 - 54
Target Start/End: Complemental strand, 1333502 - 1333462
Alignment:
14 gaaaggaaaatatggacaaattttcttttgattaaaaaagt 54  Q
    |||||||||| ||||||||||||||||||||||||||||||    
1333502 gaaaggaaaacatggacaaattttcttttgattaaaaaagt 1333462  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University